ABB 81EU01H-E modular

Description

The following procedure (adapted from references 1 & 2) is specific for the M13 cloning vector, M13KE, but could easily be adapted for
other phage (but NOT phagemid) vectors. More details can be found in reference 3. Detailed protocols for gel purification and
phenol:chloroform extractions of nucleic acid reactions may be found in reference 5.
Design. Refer to figure to design a library oligonucleotide. The sequence VPFYSHS preceding the leader peptidase cleavage site is
part of the pIII signal sequence and should not be altered. The first residue of the displayed peptide will immediately follow this
sequence. For randomized positions, relative representations of each amino acid can be improved by limiting the third position of
each codon to G or T (= A or C on the synthetic library oligonucleotide). Include a short spacer sequence between the randomized
segment and the first native pIII residue to improve target accessibility to the displayed peptide, e.g., the spacer Gly-Gly-Gly
between the random peptide and the Ser-Ala-Glu (SAE) shown in figure below. The oligonucleotide should be synthesized on a
minimum of 0.2 μmol scale, gel-purified, and accurately quantitated by measuring the OD260 in a spectrophotometer (1 absorbance
unit at 260 nm = 20 μg/ml of single stranded DNA).
2. Prepare duplex. Anneal 5 μg of the library oligonucleotide with 3 molar equivalents of the universal extension primer
5 ́-d(CATGCCCGGGTACCTTTCTATTCTC)-3 ́(approximately 4 μg for a 90-nucleotide library oligonucleotide) in a total volume of
50 μl TE containing 100 mM NaCl. Heat to 95°C and cool slowly (15–30 minutes) to less than 37°C in a thermal cycler or water bath.
Incubate at 37°C for 3–5 hours. Purify the DNA by phenol/chloroform extraction, chloroform extraction and ethanol precipitation.
5. Gel-purify the digested duplex on an 8% nondenaturing polyacrylamide gel, including 4 μl of the undigested duplex as well as DNA
marker, such as NEB #N3032. Visualize by ethidium bromide staining, and excise the digested duplex from the gel, minimizing UV
exposure time. Mince the excised band and elute the DNA by shaking overnight in several volumes of 250 mM Tris-acetate, pH 6,
1 mM EDTA, 0.1% SDS at 37°C.
6. Briefly microfuge to separate the gel fragments from the elution buffer and transfer the supernatant to a clean tube. Repeat wash to
improve yield, if desired. Purify the DNA duplex from the supernatant by phenol/chloroform extraction, chloroform extraction and
ethanol precipitation. Resuspend the pellet in 50 μl of TE and quantitate a small amount by PAGE or spectrophotometrically. One
microgram of purified insert is more than sufficient for a library of complexity 109
Preparation of Acc65I and EagI-HF Digested M13KE Vector
Digest 10–20 μg of M13KE Vector with the same enzymes used to prepare the insert above:
H2O 330 µl
NEBuffer r3.1 (10X) (NEB #B6003) 40 µl
M13KE (1 µg/µl) (NEB #N3541) 10 µl
Acc65I (10 units/µl) (NEB #R0599) 10 µl
EagI-HF (20 units/µl) (NEB #R3505) 10 µl
400 µl
Gel purify using standard methods, such as the Monarch DNA Gel Extraction Kit, NEB #T1020 or Monarch PCR and DNA Clean-up
Kit, NEB #T1030 or β-Agarase I, NEB #M0392. Quantitate a small amount of purified cut vector on an agarose gel or
spectrophotometrically

DS200RTBAG5A
DS200SBCBG1A
DS200SDCCF0AAA
DS200SDCCF1AEB
DS200SDCCF1AJC
DS200SDCCF1ALC
DS200SDCCF1AOC
DS200SDCCF1APC
DS200SDCCF1APC
DS200SDCCF1ATA
DS200SDCCF1AVC
DS200SDCCF1BAA
DS200SDCCG1A
DS200SDCCG4A